Review



restriction enzyme esp 3i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    New England Biolabs restriction enzyme esp 3i
    Restriction Enzyme Esp 3i, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 548 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/restriction+enzyme+esp+3i/Esp3I/pmc12461677-185-97-103
    Average 98 stars, based on 548 article reviews
    restriction enzyme esp 3i - by Bioz Stars, 2026-10
    98/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Cullin-5 deficiency orchestrates the tumor microenvironment to promote mammary tumor development through CREB1-CCL2 signaling
    Article Snippet: LentiCRISPRv2 (Addgene #52961), lentiCRISPRv2 blast (Addgene #98293), and lentiCRISPRv2 (Addgene #98291) were obtained from Addgene. .. We digested the plasmids with the restriction enzyme Esp 3I (BsmB I; New England Biolabs) and ligated the plasmids using the annealed sgRNA paired DNA sequences, as previously described ( ). pCW57-MCS1-2A-MCS2 (Addgene #71782) is an all-in-one doxycycline-inducible lentiviral vector for gene expression. .. We integrated human Cul5 cDNA from the plasmid pcDNA5/FRT-Flag-CUL5 (Addgene #31984) into pCW57-MCS1-2A-MCS2 and added a 3× Flag sequence on the 5′ terminal (Flag sequence: CGCGTATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGA). pcDNA3-myc-CUL5 (Addgene #19895) and pcDNA5/FRT-Flag-CUL5 (Addgene #31984) were purchased from Addgene.

    Article Title: Cullin-5 deficiency orchestrates the tumor microenvironment to promote mammary tumor development through CREB1-CCL2 signaling.
    Article Snippet: LentiCRISPRv2 (Addgene #52961), lentiCRISPRv2 blast (Addgene #98293), and lentiCRISPRv2 (Addgene #98291) were obtained from Addgene. .. We digested the plasmids with the restriction enzyme Esp 3I (BsmB I; New England Biolabs) and ligated the plasmids using the annealed sgRNA paired DNA sequences, as previously described (64). pCW57-MCS1-2A-MCS2 (Addgene #71782) is an all-in-one doxycycline-inducible lentiviral vector for gene expression. .. We integrated human Cul5 cDNA from the plasmid pcDNA5/FRT-Flag-CUL5 (Addgene #31984) into pCW57-MCS12A-MCS2 and added a 3× Flag sequence on the 5′ terminal (Flag sequence: CGCGTATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGA). pcDNA3-myc-CUL5 (Addgene #19895) and pcDNA5/ FRT-Flag-CUL5 (Addgene #31984) were purchased from Addgene.

    Gene Expression:

    Article Title: Cullin-5 deficiency orchestrates the tumor microenvironment to promote mammary tumor development through CREB1-CCL2 signaling
    Article Snippet: LentiCRISPRv2 (Addgene #52961), lentiCRISPRv2 blast (Addgene #98293), and lentiCRISPRv2 (Addgene #98291) were obtained from Addgene. .. We digested the plasmids with the restriction enzyme Esp 3I (BsmB I; New England Biolabs) and ligated the plasmids using the annealed sgRNA paired DNA sequences, as previously described ( ). pCW57-MCS1-2A-MCS2 (Addgene #71782) is an all-in-one doxycycline-inducible lentiviral vector for gene expression. .. We integrated human Cul5 cDNA from the plasmid pcDNA5/FRT-Flag-CUL5 (Addgene #31984) into pCW57-MCS1-2A-MCS2 and added a 3× Flag sequence on the 5′ terminal (Flag sequence: CGCGTATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGA). pcDNA3-myc-CUL5 (Addgene #19895) and pcDNA5/FRT-Flag-CUL5 (Addgene #31984) were purchased from Addgene.

    Article Title: Cullin-5 deficiency orchestrates the tumor microenvironment to promote mammary tumor development through CREB1-CCL2 signaling.
    Article Snippet: LentiCRISPRv2 (Addgene #52961), lentiCRISPRv2 blast (Addgene #98293), and lentiCRISPRv2 (Addgene #98291) were obtained from Addgene. .. We digested the plasmids with the restriction enzyme Esp 3I (BsmB I; New England Biolabs) and ligated the plasmids using the annealed sgRNA paired DNA sequences, as previously described (64). pCW57-MCS1-2A-MCS2 (Addgene #71782) is an all-in-one doxycycline-inducible lentiviral vector for gene expression. .. We integrated human Cul5 cDNA from the plasmid pcDNA5/FRT-Flag-CUL5 (Addgene #31984) into pCW57-MCS12A-MCS2 and added a 3× Flag sequence on the 5′ terminal (Flag sequence: CGCGTATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGA). pcDNA3-myc-CUL5 (Addgene #19895) and pcDNA5/ FRT-Flag-CUL5 (Addgene #31984) were purchased from Addgene.

    Sterility:

    Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops
    Article Snippet: The destination vector carries maize ubiquitin promoter for Cas9 expression, neomycin phosphotransferase II gene ( nptII ) for plant selection (G418; MilliporeSigma, cat. no. A1720), and a red fluorescent protein gene ( mCherry ) for visual selection (K. Lee et al., ). .. Plasmids: pCBLsgRNA (Addgene, cat. no. 199726) pCBLsgRNA1 (Addgene, cat. no. 199727) pCBLsgRNA2 (Addgene, cat. no. 199728) pCBLsgRNA3 (Addgene, cat. no. 199729) pCBLsgRNA4 (Addgene, cat. no. 199730) pCBLsgRNA5 (Addgene, cat. no. 199731) pCBLsgRNA6 (Addgene, cat. no. 199732) pCBLsgRNA7 (Addgene, cat. no. 199733) pCBLsgRNA8 (Addgene, cat. no. 199734) pYPQ142 (Addgene, cat. no. 69294) pYPQ143 (Addgene, cat. no. 69295) pYPQ144 (Addgene, cat. no. 69296) pYPQ145 (Addgene, cat. no. 69297) pYPQ146 (Addgene, cat. no. 69298) pYPQ147 (Addgene, cat. no. 69299) pYPQ148 (Addgene, cat. no. 69300) pYPQ166 (SpCas9 entry vector; Addgene, cat. no. 109328) pKL2351 (Gateway Destination Vector; Addgene, cat. no. 199721) Restriction enzyme Esp 3I, 10 U/μl (New England Biolabs, cat. no. ER0291) H 2 O, Ultrapure or molecular biology grade (sterile nuclease‐free water) DNA gel purification kit (Monarch Spin DNA Gel Extraction Kit, New England Biolabs, cat. no. T1120L) sgRNA spacer oligonucleotides, target (top) and non‐target (bottom), resuspended in sterile nuclease‐free water for a 100 μM stock solution (100 pmol/μl) As an example, we demonstrate maize Glossy2 (Gl2) gene knockout using the CRISPR/Cas9 system (K. Lee et al., , ). ..

    Gel Purification:

    Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops
    Article Snippet: The destination vector carries maize ubiquitin promoter for Cas9 expression, neomycin phosphotransferase II gene ( nptII ) for plant selection (G418; MilliporeSigma, cat. no. A1720), and a red fluorescent protein gene ( mCherry ) for visual selection (K. Lee et al., ). .. Plasmids: pCBLsgRNA (Addgene, cat. no. 199726) pCBLsgRNA1 (Addgene, cat. no. 199727) pCBLsgRNA2 (Addgene, cat. no. 199728) pCBLsgRNA3 (Addgene, cat. no. 199729) pCBLsgRNA4 (Addgene, cat. no. 199730) pCBLsgRNA5 (Addgene, cat. no. 199731) pCBLsgRNA6 (Addgene, cat. no. 199732) pCBLsgRNA7 (Addgene, cat. no. 199733) pCBLsgRNA8 (Addgene, cat. no. 199734) pYPQ142 (Addgene, cat. no. 69294) pYPQ143 (Addgene, cat. no. 69295) pYPQ144 (Addgene, cat. no. 69296) pYPQ145 (Addgene, cat. no. 69297) pYPQ146 (Addgene, cat. no. 69298) pYPQ147 (Addgene, cat. no. 69299) pYPQ148 (Addgene, cat. no. 69300) pYPQ166 (SpCas9 entry vector; Addgene, cat. no. 109328) pKL2351 (Gateway Destination Vector; Addgene, cat. no. 199721) Restriction enzyme Esp 3I, 10 U/μl (New England Biolabs, cat. no. ER0291) H 2 O, Ultrapure or molecular biology grade (sterile nuclease‐free water) DNA gel purification kit (Monarch Spin DNA Gel Extraction Kit, New England Biolabs, cat. no. T1120L) sgRNA spacer oligonucleotides, target (top) and non‐target (bottom), resuspended in sterile nuclease‐free water for a 100 μM stock solution (100 pmol/μl) As an example, we demonstrate maize Glossy2 (Gl2) gene knockout using the CRISPR/Cas9 system (K. Lee et al., , ). ..

    Gel Extraction:

    Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops
    Article Snippet: The destination vector carries maize ubiquitin promoter for Cas9 expression, neomycin phosphotransferase II gene ( nptII ) for plant selection (G418; MilliporeSigma, cat. no. A1720), and a red fluorescent protein gene ( mCherry ) for visual selection (K. Lee et al., ). .. Plasmids: pCBLsgRNA (Addgene, cat. no. 199726) pCBLsgRNA1 (Addgene, cat. no. 199727) pCBLsgRNA2 (Addgene, cat. no. 199728) pCBLsgRNA3 (Addgene, cat. no. 199729) pCBLsgRNA4 (Addgene, cat. no. 199730) pCBLsgRNA5 (Addgene, cat. no. 199731) pCBLsgRNA6 (Addgene, cat. no. 199732) pCBLsgRNA7 (Addgene, cat. no. 199733) pCBLsgRNA8 (Addgene, cat. no. 199734) pYPQ142 (Addgene, cat. no. 69294) pYPQ143 (Addgene, cat. no. 69295) pYPQ144 (Addgene, cat. no. 69296) pYPQ145 (Addgene, cat. no. 69297) pYPQ146 (Addgene, cat. no. 69298) pYPQ147 (Addgene, cat. no. 69299) pYPQ148 (Addgene, cat. no. 69300) pYPQ166 (SpCas9 entry vector; Addgene, cat. no. 109328) pKL2351 (Gateway Destination Vector; Addgene, cat. no. 199721) Restriction enzyme Esp 3I, 10 U/μl (New England Biolabs, cat. no. ER0291) H 2 O, Ultrapure or molecular biology grade (sterile nuclease‐free water) DNA gel purification kit (Monarch Spin DNA Gel Extraction Kit, New England Biolabs, cat. no. T1120L) sgRNA spacer oligonucleotides, target (top) and non‐target (bottom), resuspended in sterile nuclease‐free water for a 100 μM stock solution (100 pmol/μl) As an example, we demonstrate maize Glossy2 (Gl2) gene knockout using the CRISPR/Cas9 system (K. Lee et al., , ). ..

    Gene Knockout:

    Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops
    Article Snippet: The destination vector carries maize ubiquitin promoter for Cas9 expression, neomycin phosphotransferase II gene ( nptII ) for plant selection (G418; MilliporeSigma, cat. no. A1720), and a red fluorescent protein gene ( mCherry ) for visual selection (K. Lee et al., ). .. Plasmids: pCBLsgRNA (Addgene, cat. no. 199726) pCBLsgRNA1 (Addgene, cat. no. 199727) pCBLsgRNA2 (Addgene, cat. no. 199728) pCBLsgRNA3 (Addgene, cat. no. 199729) pCBLsgRNA4 (Addgene, cat. no. 199730) pCBLsgRNA5 (Addgene, cat. no. 199731) pCBLsgRNA6 (Addgene, cat. no. 199732) pCBLsgRNA7 (Addgene, cat. no. 199733) pCBLsgRNA8 (Addgene, cat. no. 199734) pYPQ142 (Addgene, cat. no. 69294) pYPQ143 (Addgene, cat. no. 69295) pYPQ144 (Addgene, cat. no. 69296) pYPQ145 (Addgene, cat. no. 69297) pYPQ146 (Addgene, cat. no. 69298) pYPQ147 (Addgene, cat. no. 69299) pYPQ148 (Addgene, cat. no. 69300) pYPQ166 (SpCas9 entry vector; Addgene, cat. no. 109328) pKL2351 (Gateway Destination Vector; Addgene, cat. no. 199721) Restriction enzyme Esp 3I, 10 U/μl (New England Biolabs, cat. no. ER0291) H 2 O, Ultrapure or molecular biology grade (sterile nuclease‐free water) DNA gel purification kit (Monarch Spin DNA Gel Extraction Kit, New England Biolabs, cat. no. T1120L) sgRNA spacer oligonucleotides, target (top) and non‐target (bottom), resuspended in sterile nuclease‐free water for a 100 μM stock solution (100 pmol/μl) As an example, we demonstrate maize Glossy2 (Gl2) gene knockout using the CRISPR/Cas9 system (K. Lee et al., , ). ..

    CRISPR:

    Article Title: CRISPR/Cas9‐Mediated Gene Knockout in Cereal Crops
    Article Snippet: The destination vector carries maize ubiquitin promoter for Cas9 expression, neomycin phosphotransferase II gene ( nptII ) for plant selection (G418; MilliporeSigma, cat. no. A1720), and a red fluorescent protein gene ( mCherry ) for visual selection (K. Lee et al., ). .. Plasmids: pCBLsgRNA (Addgene, cat. no. 199726) pCBLsgRNA1 (Addgene, cat. no. 199727) pCBLsgRNA2 (Addgene, cat. no. 199728) pCBLsgRNA3 (Addgene, cat. no. 199729) pCBLsgRNA4 (Addgene, cat. no. 199730) pCBLsgRNA5 (Addgene, cat. no. 199731) pCBLsgRNA6 (Addgene, cat. no. 199732) pCBLsgRNA7 (Addgene, cat. no. 199733) pCBLsgRNA8 (Addgene, cat. no. 199734) pYPQ142 (Addgene, cat. no. 69294) pYPQ143 (Addgene, cat. no. 69295) pYPQ144 (Addgene, cat. no. 69296) pYPQ145 (Addgene, cat. no. 69297) pYPQ146 (Addgene, cat. no. 69298) pYPQ147 (Addgene, cat. no. 69299) pYPQ148 (Addgene, cat. no. 69300) pYPQ166 (SpCas9 entry vector; Addgene, cat. no. 109328) pKL2351 (Gateway Destination Vector; Addgene, cat. no. 199721) Restriction enzyme Esp 3I, 10 U/μl (New England Biolabs, cat. no. ER0291) H 2 O, Ultrapure or molecular biology grade (sterile nuclease‐free water) DNA gel purification kit (Monarch Spin DNA Gel Extraction Kit, New England Biolabs, cat. no. T1120L) sgRNA spacer oligonucleotides, target (top) and non‐target (bottom), resuspended in sterile nuclease‐free water for a 100 μM stock solution (100 pmol/μl) As an example, we demonstrate maize Glossy2 (Gl2) gene knockout using the CRISPR/Cas9 system (K. Lee et al., , ). ..



    Similar Products

    restriction enzyme fastdigest esp 3i  (Thermo Fisher)
    86
    Thermo Fisher restriction enzyme fastdigest esp 3i
    Restriction Enzyme Fastdigest Esp 3i, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/restriction+enzyme+esp+3i/pmc10631719-233-1-16
    Average 86 stars, based on 1 article reviews
    restriction enzyme fastdigest esp 3i - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    restriction enzyme esp 3i  (New England Biolabs)
    98
    New England Biolabs restriction enzyme esp 3i
    Restriction Enzyme Esp 3i, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/restriction+enzyme+esp+3i/Esp3I/pmc12461677-185-97-103
    Average 98 stars, based on 1 article reviews
    restriction enzyme esp 3i - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    type ii restriction enzyme esp 3i  (New England Biolabs)
    98
    New England Biolabs type ii restriction enzyme esp 3i
    Type Ii Restriction Enzyme Esp 3i, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/restriction+enzyme+esp+3i/Esp3I/pmc11190166-91-14-20
    Average 98 stars, based on 1 article reviews
    type ii restriction enzyme esp 3i - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    restriction enzyme fastdigest esp 3i (namely, bsm bi)  (Thermo Fisher)
    90
    Thermo Fisher restriction enzyme fastdigest esp 3i (namely, bsm bi)
    Restriction Enzyme Fastdigest Esp 3i (Namely, Bsm Bi), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/restriction+enzyme+esp+3i/esp3i/pm37939173-297-1-16
    Average 90 stars, based on 1 article reviews
    restriction enzyme fastdigest esp 3i (namely, bsm bi) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    esp 3i restriction enzyme recognition sites  (New England Biolabs)
    98
    New England Biolabs esp 3i restriction enzyme recognition sites
    Esp 3i Restriction Enzyme Recognition Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/restriction+enzyme+esp+3i/Esp3I/pm37235660-309-10-16
    Average 98 stars, based on 1 article reviews
    esp 3i restriction enzyme recognition sites - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier

    Image Search Results